Role of PE35 Antigen of Mycobacterium tuberculosis in Cell Culture Model
Ramanujam Saravanan, Bhuvanasundar Renganathan, Jyotirmay Biswas, Konerirajapuram Natarajan Sulochana
Sarvodaya International Journal of Medicine · 2025-04
Abstract
INTRODUCTION Eales’ disease (ED) is an inflammation disease usually reported in young males aged 15–45 in India. Vision loss results from repeated vitreous hemorrhage.[1,2] The etiology of the disease is multifactorial and remains unclear. Many authors had favored the association of Mycobacterium tuberculosis (M. tb) with the ED. Moreover, in vitreous and epiretinal membranes in ED patients, M. tb genes but no culturally viable organisms were identified.[3-7] Moreover, a study involving 1005 tuberculosis patients reported no cases of ED.[8] Clinical presentation of tubercular uveitis (typically associated with vitreous snowball opacities) differs from ED. Exposure to tuberculosis results in tuberculin hypersensitivity, which is indicated by a positive Mantoux test and frequently observed in many ED patients. Hence, numerous researchers endorse the hypothesis that ED is attributable to tuberculoprotein hypersensitivity. Earlier, Ashton hypothesized that ED could be a hypersensitivity reaction to mycobacterium protein mediated through retinal pigment epithelium (RPE) cells.[9] The retina’s immune privilege is preserved by blood retinal barriers (BRB). Retinal Pigment epithelial with RPE cells contribute to this by phagocytosing microbes and forming the outer BRB, regulating fluids and toxins. RPE cells express various molecules such as Fas ligand, adhesion molecules, major histocompatibility complex molecules, and cytokines. Inflammation triggers the secretion of cytokines such as tumor necrosis factor (TNF)-α, interleukin (IL)-8, MCP-1, and IL-6.[10-12] Elevated C-reactive protein and IL-6 and other pro-inflammatory cytokines levels were observed in blood, vitreous samples of ED patients.[13] Inflammation of the retinal epithelia results in the occlusion of the vascular lumen and subsequent retinal ischemia and neo angiogenesis.[14-16] We probed for the presence of tubercular protein in peripheral blood mononuclear cell (PBMCs) by mass spectrometry and identified the mycobacterial PE35 antigen. We evaluated the role of the identified protein on the expression of inflammatory proteins using a human RPE cell culture system (ARPE-19 cell lines). MATERIALS AND METHODS All human experiments followed the Declaration of Helsinki. The study was approved by the ethics committee of the institute. In brief, the study included 20 men with ED and age- and sex-matched healthy controls without any history of ED. Inclusion criteria were: Patients diagnosed with ED by an ophthalmologist (cases of retinal phelebitis and excluding any other mimicking diseases), no other systemic inflammatory or ocular disease, no medications, and no smoking or alcohol habits. Healthy volunteers met the same criteria, except for having no ED, and served as control subjects. Clinical histories and informed consent were obtained from all participants. Sample and materials Each participant provided 8 mL of blood in a heparinized vial. PBMCs were isolated through Ficoll density gradient centrifugation. The plasmid pQE 30-Xa was transfected and propagated in E. coli M15. The ARPE-19 cell line and M. tb H37Rv strain were sourced from the ATCC™. Chemicals were acquired from Merck Millipore, Bio-Rad, and Sigma-Aldrich. Mass spectrometric identification of Mycobacterium tuberculosis protein in peripheral blood mononuclear cell PBMC samples were lysed with 100 μL of a buffer containing 2% RapiGest, 1 mM ethylenediaminetetraacetic acid, and 50 mM 4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid buffer at pH 7.2. The samples were subjected to reduction using 100 mM dithiothreitol at 56°C for 30 min, followed by alkylation with 200 mM iodoacetamide at room temperature for an additional 30 min. Subsequently, the samples were subjected to overnight digestion with 1 μg trypsin in 100 mM ammonium bicarbonate at 37°C. Trypsin activity was stopped by the addition of 2 μL of formic acid, followed by incubation at 37°C for 20 min. The samples were filtered, centrifuged at 14,000 rpm for 10 min, dried, and reconstituted in 40 μL of 2% acetonitrile and 0.1% formic acid in Milli-Q water. Samples were analyzed using the Nano ACQUITY UPLC system and Xevo G2 Q TOF mass spectrometer. Data were processed with Protein Lynx Global Server v2.4.5 against the M. tb database, including additional protein sequences. The fixed modification was Carbamidomethyl-C; variable modifications included oxidation of methionine N-terminal acetylation, deamidation of glutamine and asparagine. One missed cleavage site was allowed, requiring at least three fragment ions per peptide, seven in total, and one peptide per protein, with a 4% false discovery rate. Molecular cloning of PE35 gene Genomic DNA of M. tb was used to amplify and clone the PE35 gene. The PE35 nucleotide sequence (NC_000962.3, NM_002317.5) was retrieved from NCBI, located between 4,350,745 and 4,351,044 bp (300 bp). Primers were designed to target the CDS region for amplification. The designed infusion cloning primers (Forward: 5’GGTATCGAGGGAAGGCCTATGGAAAAAATGTCACATGATC3’(Stu I), Reverse: 5’TCAGCTAATTAAGCTTCTATTCGGCGAAGACGCC3’ (HIND III)) were utilized. PCR involved denaturation (94°C for 30 s), annealing (58°C for 30 s), and extension (72°C for 1 min) over 36 cycles [Supplement Figure 2a].Supplementary Figure 1: Detection of mycobacterial PE35 DNA in peripheral blood mononuclear cell (PBMC). Representative image of PE35 screening in PBMC of controls and Eales’ disease (ED) patients. Representative image of polymerase chain reaction PCR results obtained with DNAs extracted from the PBMC samples from patients with Eales’ disease and control samples from healthy individuals and resolved in 2% ethidium bromide stained agarose gel. PE35 DNA was identified only in samples obtained from ED patients. The lanes are shown: MW: Molecular weight markers, PC: Positive control, control: Samples from healthy volunteers, ED: Eales’ disease patients sample and NTC: No template controlSupplementary Figure 2: (a) Polymerase chain reaction (PCR) amplification of PE35 inserts. Agarose gel electrophoresis for PCR amplified PE35 DNA insert. Lane 1: MW Molecular size marker (100 – 1000 bp) Lane 2 and 3: NTC - no template control Lane 4 and 5: PCR amplified PE35 DNA insert (300 bp). (b) Confirmation of pQE-30Xa+PE35. Agarose gel electrophoresis of pQE-30Xa+PE35 vector digested using restriction enzymes StuI and HindIII. MW- Molecular size marker (0.5 bp – 10 Kbp); Lane 1: pQE-30Xa vector; Lane 2 and 3: pQE-30Xa + PE35 vector digestedVector construction, expression and confirmation of PE35 product The pQE30-Xa vector was linearized with StuI and HindIII. and PE35 product and linearized vector in a 2:1 ratio, infusion enzyme premix, and molecular grade water, was incubated at 50°C for 15 min. The resulting in-fusion product was introduced into chemically competent E. coli M15 cells through an ice incubation step of 30 min, followed by heat shock at 42°C for 45 s. Subsequently the cells were allowed to recover for 1 h after the addition of 750 μL of LB broth. After recovery, the cells were centrifuged, resuspended in 200 μL of LB broth, and plated on LB agar with kanamycin (25 μg/mL) and ampicillin (100 μg/mL). StuI and HindIII digestion of antibiotic-resistant E. coli plasmid DNA revealed 300 bp and 3500 bp bands, confirming the presence of pQE-30 Xa + PE35 in M15 (pREP4) E. coli. Sequencing showed a 100% match to the NCBI’s PE35 sequence, with no mutations [Supplement Figure 2b]. Overexpression and purification of recombinant PE35 Colonies were inoculated in tubes containing 5 mL of LB medium supplemented with 100 μg/mL ampicillin and 25 μg/mL kanamycin. The cultures were incubated overnight at 37°C in an orbital shaker set to 250 rpm. The plasmid was digested with Stu I and Hind. PCR confirmed the insert. The expression of PE35 protein in M15 E. coli was induced using 0.2 mM IPTG for 4 h at 30°C. Cells were centrifuged at 7500 rpm for 30 min at 4°C, lysed, and supernatants collected, further centrifuged at 10,000 rpm, then passed through a Ni-NTA column. PE35 was eluted and purified, yielding a 9.9 kDa band (1 mg per 100 mL broth). Purity was verified by SDS-PAGE and western blotting using an anti-His tag antibody [Supplement Figure 3a].[17]Supplementary Figure 3: (a) Silver stained 10 % SDS-PAGE gel showing the Ni-NTA affinity purification. Lane 1: Molecular size marker; Lane 2-4: Crude cell lysates; Lane 5-6: Ni-NTA unbound fraction; Lanes 7-8: fractions from 25 mM imidazole wash 1-2; Lanes 9-18: 250 mM imidazole eluted fraction (elutions 9 - 10). (b) Confirmation of purified PE35 by western blot. Lane 1: Molecular weight marker, Lane 2: immunoreactivity in Ni-NTA purified PE35 sample probed with His tag antibodiesWestern blot Purified PE35 proteins with a 6X His tag was identified by western blot. Protein was separated using 12% SDS-PAGE and transferred to a methanol-pre-wetted PVDF membrane. The membrane was blocked with 5% BSA in TBST (pH 7.4) for 1 h at room temperature, then incubated overnight at 4°C with a primary His tag antibody (Rabbit, 2365, 1:1000) in 2.5% BSA. After three washes with TBST, an HRP-conjugated anti-rabbit secondary antibody (mouse, sc-2357, 1:10,000) was incubated at room temperature for 2 h. The membranes were washed three times in PBST, developed with Clarity ECL reagent, and imaged using a FluorChem FC3 analyzer (ProteinSimple, USA) [Supplement Figure 3b]. Cell culture procedure ARPE-19 were cultured in DMEM-F12 with 10% FBS at 37°C in 5% CO2. Approximately 5 × 10^4 cells were seeded into 12-well plates and cultured until they reached 75% confluence. The cells were then serum-starved overnight in DMEM-F12 with 1% FBS. Following this, cells were treated with 1 ng–10 μg/mL recombinant PE35 for 24 h to induce inflammation. Statistical analysis Data expressed as mean ± standard error of the mean Statistical analysis was performed using one-way ANOVA to compare the difference among PE35-treated ARPE-19 cells, with Prism software (version 5.0). RESULTS Identification of Mycobacterium tuberculosis PE35 protein by mass spectrometry Our analysis has detected mycobacterial antigen proteins in the PBMCs of ED patients [Supplement Figure 1], and no proteins were found in the PBMC samples from control subjects [Table 1].Table 1: The list of mycobacterial proteins identified in peripheral blood mononuclear cell of emergency department patientsNo toxicity was observed in ARPE-19 cells at tested concentrations Viability of ARPE-19 treated with PE35 of concentrations from 0.1 ng/mL to 10 μg/mL for 24 h was evaluated. The percentage cell viability was estimated and found PE35 was not toxic to the cells at the tested concentrations [Figure 1].Figure 1: Cytotoxicity of PE35 in ARPE-19 cells by MTT assay. Cell viability after PE35 treatment was found to be more than 90% at all tested concentrationsPE35 induced the expression of MCP-1, interleukin-8, and tumor necrosis factor-α genes The mRNA expression levels of the pro-inflammatory cytokines IL-8, IL-6, MCP-1, and TNF-α were assessed in ARPE-19 cells exposed to varying concentrations of PE35 (1, 10, 100, 1000, and 10000 ng/mL) for 24 h. Treatment with PE35 at a concentration of 10 μg/mL resulted in an 8-fold increase in IL-8 mRNA expression, a 2.7-fold increase in TNF-α mRNA expression, and a 3-fold increase in MCP-1 mRNA expression. The results are expressed as fold changes [Figure 2].Figure 2: Inflammation is induced by PE35 in a dose-dependent manner. ARPE-19 cells were incubated in serum-free medium overnight and were stimulated with purified recombinant PE35 protein in concentrations ranging from (0.1 to 10,000 ng/mL. The mRNA expressions of pro-inflammatory cytokines were measured after 24 h. With 10 μg/mL of treatment, mRNA expression of all three cytokines except (a) interleukin (IL)-6 (Ns) were observed to rise by 7 folds of expression of (b) IL-8 (P < 0.001), (c) 8 folds of MCP - 1 (P < 0.001) and (d) 2.7 folds of tumor necrosis factor-α: (P < 0.001), when compared to untreated cells. One way ANOVA was used for statistical analysisDISCUSSION ED is believed to be a hypersensitive reaction to tubercular protein. Individuals with this condition frequently test positive on the Montoux test.[4-7] However, given that approximately 70% of healthy adults in India exhibit Montoux positivity due to BCG vaccination,[14] it is essential to have reliable and specific indicators to establish a definitive link between M. tb and ED. For the first time, we have identified the presence of the M. tb PE35 antigen (Rv3872) in ED patients at both gene and protein levels. The PE35 antigen, part of the PE_PPE protein family with proline-glutamate residues, is in the RD1 locus. This region, absent in M. bovis BCG vaccine strains, is crucial for the ESX-1 secretion system, which secretes virulence-associated proteins CFP-10 and ESAT-6. In animal models, treatment with recombinant RD1 antigens such as PE35, PPE68, CFP10, and ESAT-6 specifically induced delayed-type hypersensitivity responses exclusively in animals exposed to M. tb species.[18] The presence of the PE35 antigen in patients supports the hypothesis that ED is a hypersensitivity reaction to tuberculosis. Studies show that PE35 treatment in macrophage cell lines increases the expression of IL-8, MCP-1, MMP-9, vascular endothelial growth factor (VEGF), VEGF receptor, CCR3, L-1 β, IL-2, and TNF-α.[19-21] The retinal pigment epithelium (RPE) is involved in phagocytosis of the eye. Our results show that 10 μg of PE35 treatment increases mRNA expression of IL-8, TNF-α, and MCP-1. Moreover, elevated IL-8 and MCP-1was reported in vitreous samples from ED patients.[22] MCP-1 induces recruitment of monocytes, whereas the T cells facilitate endothelial migration during M. tb infection. IL-8 promotes angiogenesis by inducing endothelial cell migration and sprouting in in vitro models.[23] It recruits neutrophils to inflammation sites and affects endothelial cells by enhancing proliferation, survival, and angiogenesis regulation.[24] TNF-α levels were elevated in ED patients and correlated disease severity.[25] TNF-α induces inflammatory responses in vascular endothelial cells, resulting in increased leukocyte adhesion, migration, permeability, and thrombosis.[26] In this study, we found that PE35 induced the transcription of cytokines IL-8, MCP-1, and TNF-α in retinal pigment epithelium culture. Studies have demonstrated these cytokines are elevated in the serum and vitreous of ED patients. This study is the first of its kind to suggest PE35’s potential role in ED, based on its effects in cultured RPE cell lines. A limitation is we did not confirm PE35 presence in ocular samples from ED patients. Future research should explore PE35’s role in ocular inflammation and develop targeted treatments for ED. Financial support and sponsorship Nil. Conflicts of interest There are no conflicts of interest.
MeSH terms
- Mycobacterium tuberculosis
- Antigen
- Microbiology
- Tuberculosis
- Mycobacterium
- Virology
- Biology
- Immunology